
Bednarski W, et al. Utilization of beet molasses and whey for fat biosynthesis by a yeast. Agric. Wastes 18: 19-26, 1986. 
Bednarski W, et al. Utilization of beet molasses and whey for fat biosynthesis by a yeast. Agric. Wastes 18: 19-26, 1986. 
Hassan M, et al. Production of single-cell oil from prickly-pear juice fermentation by Cryptococcus curvatus grown in batch culture. World J. Microbiol. Biotechnol. 10: 534-537, 1994. 
Floetenmeyer MD, et al. Continuous culture fermentation of whey permeate to produce microbial oil. J. Dairy Sci. 68: 633-637, 1985. Ref
Bednarski W, et al. Utilization of beet molasses and whey for fat biosynthesis by a yeast. Agric. Wastes 18: 19-26, 1986. 
West M, et al. Purification and properties of two lactose hydrolases from Trichosporon cutaneum. J. Gen. Microbiol. 136: 1483-1490, 1990. PubMed: 2124610
Brown BD, et al. A relationship between growth and lipid accumulation in Candida curvata D. J. Ferment. Bioeng. 68: 344-352, 1989. Ref
Ykema A, et al. Growth yield, maintenance requirements, and lipid formation in the oleaginous yeast Apiotrichum curvatum. Biotechnol. Bioeng. 34: 1268-1276, 1989. Ref
Ykema A, et al. Optimization of lipid production in the oleaginous yeast Apiotrichum curvatum in whey permeate. Appl. Microbiol. Biotechnol. 29: 211-218, 1988. Ref
Verwoert II, et al. Modification of the fatty-acid composition in lipids of the oleaginous yeast Apiotrichum curvatum by intraspecific spheroplast fusion. Appl. Microbiol. Biotechnol. 32: 327-333, 1989. (Moon NJ, Hammond EG. Process for converting whey permeate to oil-containing yeast. US Patent 4,235,933 dated Nov 25 1980) Ref
Wang LW, et al. Spectrophotometric determination of polar and non-polar lipids in oleaginous yeast. World J. Microbiol. Biotechnol. 9: 350-352, 1993. Ref
Hassan M, et al. Production of single-cell oil from prickly-pear juice fermentation by Cryptococcus curvatus grown in batch culture. World J. Microbiol. Biotechnol. 10: 534-537, 1994. Ref
Floetenmeyer MD, et al. Continuous culture fermentation of whey permeate to produce microbial oil. J. Dairy Sci. 68: 633-637, 1985. Ref
Bednarski W, et al. Utilization of beet molasses and whey for fat biosynthesis by a yeast. Agric. Wastes 18: 19-26, 1986. 
Hassan M, et al. Production of single-cell oil from prickly-pear juice fermentation by Cryptococcus curvatus grown in batch culture. World J. Microbiol. Biotechnol. 10: 534-537, 1994. Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Yes

Hassan M, et al. Influence of nitrogen and iron limitations on lipid production by Cryptococcus curvatus grown in batch and fed-batch culture. Process Biochem. 31: 355-361, 1996. 
Park WS, et al. Evidence of peroxisomes and peroxisomal enzyme activities in the oleaginous yeast Apiotrichum curvatum. Can. J. Microbiol. 37: 361-367, 1991. PubMed: 1878814GTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGAATTGCTCTTTGAGCGTTAACTACATCCATCTACATCTGTGAACTGTTGATTGACTTCGGTCAATAACTTTTACAAACACTGTGTAATGAACGTCATGTTATTATAACAAAAATAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAACTTGCGCTCTCTGGTATTCCGGAGAGCATGCCTGTTTGAGTATCATGAAATCTCAACCATTAGGGTTTCTTAATGGCTTGGAATTGGGCGCTGCCACTTGCCTGGCTCGCCTTAAAAGAGTTAGCGTGTTAAACTTGTCGTAAACTGGCGTAATAAGTTTCGCTGGTGGTAGACTTGTGAAGGACGCTTCTAATCGTCTTCGGACACTTCTTGAACTCTGGTCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCTTAGTAACGGCGAGTGAACCGGGAAAAGCTCAAATTTGTAATCTGGCTGTCTTCGATAGTCCGAGTTGTAATCTATAGACGTGTTTTCCGTGCTGGACCGTATCTAAGTCCCTTGGAACAGGGTATCAAAGAGGGTGACAATCCCGTGCTTGATACGACCACCAGTGCTCTGTGATACACGTTCTACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGTTCTTCAGATTCAGCTGGTTCTTCCAGTCTACTTCTGTGGAACGGGTCAACATCAGTTTTGTCCGGTGGATAAAGGTAGTAGGAATGTGACTCCCCCGGGAGTGTTATAGCCTATTATTGCATACACTGGGTGAGACTGAGGACTGCAGCTCGCCTTTTGGCCGGTCTTCGGACACGTTCGAGCTTAGGATGTTGACATAATGGCTTTAAACGAC
CATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCTTAGTAACGGCGAGTGAACCGGGAAAAGCTCAAATTTGTAATCTGGCTGTCTTCGATAGTCCGAGTTGTAATCTATAGACGTGTTTTCCGTGCTGGACCGTATCTAAGTCCCTTGGAACAGGGTATCAAAGAGGGTGACAATCCCGTGCTTGATACGACCACCAGTGCTCTGTGATACACGTTCTACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGTTCTTCAGATTCAGCTGGTTCTTCCAGTCTACTTCTGTGGAACGGGTCAACATCAGTTTTGTCCGGTGGATAAAGGTAGTAGGAATGTGACTCCCCCGGGAGTGTTATAGCCTATTATTGCATACACTGGGTGAGACTGAGGACTGCAGCTCGCCTTTTGGCCGGTCTTCGGACACGTTCGAGCTTAGGATGTTGACATAATGGCTTTAAACGACCCGTC
Nucleotide (GenBank) : Y12080 A.curvatum mRNA for SIS1 protein.
Nucleotide (GenBank) : Y10421 C.curvatus strain ATCC 20509 Ole1 gene.
Nucleotide (GenBank) : Y12079 A.curvatum mRNA for heat shock protein 70.
Nucleotide (GenBank) : HM802135 ITS including 5.8S rRNA gene and D1/D2 region of 26S rRNA gene
Nucleotide (GenBank) : MATS00000000 Cutaneotrichosporon curvatus strain ATCC 20509, whole genome shotgun sequencing project
Yu X, et al. Oil production by oleaginous yeasts using the hydrolysate from pretreatment of wheat straw with dilute sulfuric acid. Bioresour. Technol. 102: 6134-6140, 2011. PubMed: 21463940
Gujjari P, et al. Characterization of oleaginous yeasts revealed two novel species: Trichosporon cacaoliposimilis sp. nov. and Trichosporon oleaginosus sp. nov. Mycologia. 103:1110-1118, 2011. PubMed: 21558504
Hassan M, et al. Influence of nitrogen and iron limitations on lipid production by Cryptococcus curvatus grown in batch and fed-batch culture. Process Biochem. 31: 355-361, 1996.
Bednarski W, et al. Utilization of beet molasses and whey for fat biosynthesis by a yeast. Agric. Wastes 18: 19-26, 1986.
Brown BD, et al. A relationship between growth and lipid accumulation in Candida curvata D. J. Ferment. Bioeng. 68: 344-352, 1989.
Floetenmeyer MD, et al. Continuous culture fermentation of whey permeate to produce microbial oil. J. Dairy Sci. 68: 633-637, 1985.
Hassan M, et al. Production of single-cell oil from prickly-pear juice fermentation by Cryptococcus curvatus grown in batch culture. World J. Microbiol. Biotechnol. 10: 534-537, 1994.
Moon NJ, Hammond EG. Process for converting whey permeate to oil-containing yeast. US Patent 4,235,933 dated Nov 25 1980
Verwoert II, et al. Modification of the fatty-acid composition in lipids of the oleaginous yeast Apiotrichum curvatum by intraspecific spheroplast fusion. Appl. Microbiol. Biotechnol. 32: 327-333, 1989.
Wang LW, et al. Spectrophotometric determination of polar and non-polar lipids in oleaginous yeast. World J. Microbiol. Biotechnol. 9: 350-352, 1993.
Park WS, et al. Evidence of peroxisomes and peroxisomal enzyme activities in the oleaginous yeast Apiotrichum curvatum. Can. J. Microbiol. 37: 361-367, 1991. PubMed: 1878814
West M, et al. Purification and properties of two lactose hydrolases from Trichosporon cutaneum. J. Gen. Microbiol. 136: 1483-1490, 1990. PubMed: 2124610
Ykema A, et al. Growth yield, maintenance requirements, and lipid formation in the oleaginous yeast Apiotrichum curvatum. Biotechnol. Bioeng. 34: 1268-1276, 1989.
Ykema A, et al. Optimization of lipid production in the oleaginous yeast Apiotrichum curvatum in whey permeate. Appl. Microbiol. Biotechnol. 29: 211-218, 1988.
Close D, Ojumu J. Draft Genome Sequence of the Oleaginous Yeast Cryptococcus curvatus ATCC 20509. Genome Announc 4(6). pii: e01235-16, 2016. PubMed: 27811111
Liu XZ, et al. Towards an integrated phylogenetic classification of the Tremellomycetes. Stud. Mycol. 81: 85-147, 2015. PubMed: 26955199
