| 產(chǎn)品名稱 |
Aspergillus lentulus Balajee et Marr |
| 商品貨號 |
B189627 |
| Deposited As |
Aspergillus lentulus |
| Strain Designations |
FH5 [IFM 54703, CBS 117885, NRRL 35552] |
| Application |
Biomedical Research and Development Material |
| Biosafety Level |
2
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format |
frozen |
| Storage Conditions |
Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section |
| Type Strain |
yes |
| Preceptrol® |
no |
| Genome Sequenced Strain |
Yes
|
| Comments |
Clinical isolate Genome sequencing strain (Medical Mycology Research Center, Chiba University, Japan) |
| Morphology |
Colonies on MEA attain a diameter of 30 to 35 mm after 7 days at 25°C and 50 to 55 mm after 7 days at 37°C. Colony texture is mostly floccose, and colonies are usually white, interspersed with olive-green colonies. Isolates often sporulate poorly, giving the colony a whitish appearance. In reverse, colonies are yellow in color with no diffusible pigment. |
| Medium |
ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 324: Malt extract agar
ATCC® Medium 336: Potato dextrose agar (PDA)
|
| Growth Conditions |
Temperature: 25°C to 30°C Atmosphere: Typical aerobic |
| Sequenced Data |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTCTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGTTTCGACGGCCGCCGGGGAGGCCTCGCGCCCCCGGGCCCGCGCCCGCCGAAGACCCCAACATGAACGCTGTTCTGAAAGTATGCAGTCTGAGTTGATTATCATAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCCCTCCCCCGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCCAGCCGACACCCAACTTTATTTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA
D1D2 region of the 28S ribosomal RNA gene
ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCCCCCTCGGGGTCCGCGTTGTAATTTGCAGAGGATGCTTCGGGTGCAGCCCCCGTCTAAGTGCCCTGGAACGGGCCGTCATAGAGGGTGAGAATCCCGTCTGGGACGGGGTGTCTGCGTCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACTCGCCCGCGGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCCGTGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCCTCGGAATGTATCACCTCTCGGGGTGTCTTATAGCCGAGGGTGCAATGCGGCCTGCCCGGACCGAGGAACGCGCTTCGGCTCGGACGCTGGCGTAATGGTCGTAAATGAC
|
| Name of Depositor |
KA Marr, K Lafe |
| Special Collection |
NSF - Mycology |
| Chain of Custody |
ATCC <-- KA Marr, K Lafe K A Marr Fred Hutchinson Cancer Research Center |
| Isolation |
Clinical specimen of a patient hospitalized at the Fred Hutchinson Cancer Research Center, Seattle, WA, USA. |
| Year of Origin |
July 2, 2000 |
| Cross References |
Nucleotide (GenBank) :
BCLY00000000
Aspergillus lentulus strain IFM 54703, whole genome shotgun sequencing project
|
| References |
Balajee SA, et al. Aspergillus lentulus sp. nov., a new sibling species of A. fumigatus. Eukaryot. Cell 4: 625-632, 2005. PubMed: 15755924
Kusuya Y, et al. Draft genome sequence of the pathogenic filamentous fungus Aspergillus lentulus IFM 54703T. Genome Announc 4(1): e01568-15, 2016. PubMed: 26769945
Staab JF, Kahn JN, Marr KA. Differential Aspergillus lentulus echinocandin susceptibilities are Fksp independent. Antimicrob Agents Chemother 54: 4992-4998, 2010. PubMed: 20855747
Hong SB, et al. Polyphasic taxonomy of Aspergillus fumigatus and related species. Mycologia 97: 1316-1329, 2005. PubMed: 16722222
|
