| 產品名稱 |
Trichoderma atroviride Karsten sensu Bissett |
| 商品貨號 |
B191742 |
| Deposited As |
Trichoderma lignorum (Tode) Harz, anamorph |
| Strain Designations |
2440A [CBS 391.92] |
| Alternate State |
Hypocrea atroviridis Dodd et al. |
| Application |
produces peptaibol antibiotics |
| Biosafety Level |
1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format |
freeze-dried |
| Type Strain |
no |
| Preceptrol® |
no |
| Comments |
postharvest decay of citrus fruit |
| Morphology |
After 12 days on Blakeslee’s malt extract medium at 25°C, colony is low to floccose, mycelium white to yellow, conidial areas green, reverse uncolored. Chlamydospores globose, hyaline, intercalary or terminal on short branches. Conidiophores hyaline, with pyramidal branching, phialides in terminal verticils. Conidia subglobose, smooth-walled, green. |
| Medium |
ATCC® Medium 325: Malt extract agar (Blakeslee's formula)
ATCC® Medium 336: Potato dextrose agar (PDA)
|
| Growth Conditions |
Temperature: 24°C |
| Sequenced Data |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence.
GGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACCATACCAAACTGTTGCCTCGGCGGGGTCACGCCCCGGGTGCGTCGCAGCCCCGGAACCAGGCGCCCGCCGGAGGGACCAACCAAACTCTTTTCTGTAGTCCCCTCGCGGACGTTATTTCTTACAGCTCTGAGCAAAAATTCAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGACCTCGGGAGCCCCTAAGACGGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACAACTCGCACCGGGAGCGCGGCGCGTCCACGTCCGTAAAACACCCAACTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAAC
|
| Name of Depositor |
D Knosel |
| Isolation |
lemon |
| Cross References |
Nucleotide (GenBank) :
AF049075
Trichoderma harzianum internal transcribed spacer 1, partial
Nucleotide (GenBank) :
U05192
Trichoderma harzianum orotidine-5'-phosphate decarboxylase (pyr4)
Nucleotide (GenBank) :
AF276093
Trichoderma atroviride strain ATCC 36042 small subunit ribosomal
Nucleotide (GenBank) :
AF278796
Trichoderma atroviride strain ATCC 36042 18S ribosomal RNA gene,
Nucleotide (GenBank) :
AF276651
Trichoderma atroviride strain ATCC 36042 endochitinase 42 (ech42)
Nucleotide (GenBank) :
Z48812
internal transcribed spacers, ITS-1 and ITS-2, and the 5.8S ribosomal DNA, sequences
|
| References |
. . Phytopathol. Z. 85: 217-226, 1976.
Schirmbock M, et al. Parallel formation and synergism of hydrolytic enzymes and peptaibol antibiotics, molecular mechanisms involved in the antagonistic action of Trichoderma harzianum against phytopathogenic fungi. Appl. Environ. Microbiol. 60: 4364-4370, 1994. PubMed: 7811076
Ospina-Giraldo MD, et al. Phylogenetic relationships of Trichoderma harzianum causing mushroom green mold in Europe and North America to other species of Trichoderma from world-wide sources. Mycologia 90: 76-81, 1998.
|
