| 產品名稱 |
HFBCP87 |
| 商品貨號 |
B193783 |
| Designations |
HFBCP87 |
| GenBank Number |
M85923
|
| Species |
Homo sapiens, human |
| Applications |
The predicted product size is (bp): 107. The observed product size(s) is(are) (bp): 108 (human); 108 (CHO cells). |
| Vector |
Construct size (kb): 5.0 DESCRIPTION OF VECTOR COMPONENT:
Name of vector: pBluescript SK-
Intact vector size: 2.960
Type of vector: phagemid
Vector end: EcoRI
Vector end: EcoRI
Cloning sites: KpnI ApaI DraII XhoI (SalI HincII AccI) ClaI HindIII EcoRV
EcoRI PstI SmaI BamHI SpeI XbaI EagI NotI SacII BstXI SacI
Polylinker sites: SacI BstXI SacII NotI EagI XbaI SpeI BamHI SmaI PstI EcoRI
EcoRV HindIII (ClaI Bsp106I) (HincII AccI SalI) XhoI
(Eco0109I DraII ApaI) KpnI
Construction: pUC19
Host range: Escherichia coli
Features (with orientation and position when available):
replicon: f1, ->
insert detection: lacZ', <-
primer site: M13-20, ->
promoter: T7, ->
MCS: KpnI...SacI, ->
promoter: T3, <-
promoter: lac, <-
primer site: M13 reverse, <-
replicon: pMB1
marker(s): ampR, <-
Cross references: |
| Insert |
DNA: cDNA DESCRIPTION OF INSERT COMPONENT:
Genome: Homo sapiens
Gene symbol: D1S349E
Genomic copy number: unique
Gene name: DNA Segment, single copy, expressed
Contains complete coding sequence?: N
Chromosome: 1; Localization: 1 p31-p32
Genome: Homo sapiens
Gene symbol: PDE4B
Gene name: phosphodiesterase, cyclic AMP-specific (rolipram sensitive)
Contains complete coding sequence?: N
Chromosome: 1; Localization: 1 p31
Tissue: fetal brain, female, 17-18 wk (Stratagene 936206)
Type of DNA: cDNA
Insert end: Modification: EcoRI linkers
Insert end: Modification: EcoRI linkers
Insert size (kb): 2.0
Cross references: DNA Seq. Acc.: M85923; EST: EST02447; Primer: M13 Forward;
THC id: THC106075
DNA Seq. Acc.: M97515; EST: EST02447; Primer: M13 Forward
Nucleotides 1-367 of the insert correspond to
nucleotides 687-1053 of M97515 with 98% identity.
DNA Seq. Acc.: M97515; EST: EST02926; Primer: M13 Reverse
Nucleotides 281-1 of the insert correspond to
nucleotides 2366-2646 of M97515 with 98% identity.
DNA Seq. Acc.: T05038; EST: EST02926; Primer: M13 Reverse;
THC id: THC106075 Insert lengths(kb): 2.0 Tissue: fetal brain, female, 17-18 wk (Stratagene 936206) Gene product: phosphodiesterase, cyclic AMP-specific (rolipram sensitive) [PDE4B] |
| Insert Size (kb) |
2.0 |
| Biosafety Level |
1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Shipping Information |
Distributed: DNA (dried). Rehydrate with TE. (amount: 200 ng) |
| Comments |
Restriction digests of the clone give the following sizes (kb): EcoRI--3.0, 2.0; BamHI--5.0; HindIII--3.15, 1.55, 0.3; PstI--5.0. Corresponds to nt 687-2646 of GenBank M97515, encoding part of the coding sequence (nt 282-1976) and part of the 3' untranslated region. EST02447 can be detected in genomic DNA using the following oligonucleotides (5'-3'): TCCAGGAAAGAGACCTCCTA and GTTGTGATATGCCACGTCAG. The predicted product size is (bp): 107. The observed product size(s) is(are) (bp): 108 (human); 108 (CHO cells). |
| References |
Korenberg JR, et al. Toward a cDNA map of the human genome. Genomics 29: 364-370, 1995. PubMed: 8666383
Adams MD, et al. Sequence identification of 2,375 human brain genes. Nature 355: 632-634, 1992. PubMed: 1538749
Maglott DR, et al259 human brain expressed sequence tags (ESTs): chromosome localization, subregional assignment, and sequence analysisIn: Maglott DR, et alIdentification of transcribed sequencesNew YorkPlenum Presspp. 273-288, 1994
Adams MD, et al. 3400 expressed sequence tags identify diversity of transcripts from human brain. Nat. Genet. 4: 256-267, 1993. PubMed: 8358434
|
