ATCC® Genuine Nucleics can be used for assay development, verification, validation, monitoring of day to day test variation, and lot to lot performance of molecular-based assays. The quantitative format allows for the generation of a standard curve for quantitative PCR (qPCR) to determine viral load.
Biosafety Level
1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Product Format
frozen Specification range: 1 x 105 - 1 x 106 copies/μL 100 µL per vial with Biomatrica RNAstable
Storage Conditions
-70°C or colder
Intended Use
The synthetically engineered sequence of the product constitutes intellectual property belonging to ATCC. Unauthorized use, including sequencing, modification, or reverse-engineering, of the product is expressly prohibited without prior ATCC consent.
Comments
Manufactured under ISO 13485 guidance
Preparation includes fragments from the capsid, membrane, and envelope regions.
The following primers and probe can be used with this nucleic acid preparation RefCenters for Disease Control and Prevention (CDC). CDC DENV-1-4 Real-Time RT-PCR Assay for Detection and Serotype Identification of Dengue Virus. Instructions for Use Package Insert.:
Forward primer: GGACTRGACACACGCACCCA
Reverse primer: CATGTCTCTACCTTCTCGACTTGYCT
Probe: ACCTGGATGTCGGCTGAAGGAGCTTG
Special Collection
RNA
References
Waggoner JJ, et al. Development of an internally controlled real-time reverse transcriptase PCR assay for pan-dengue virus detection and comparison of four molecular dengue virus detection assays. J. Clin. Microbiol. 51(7): 2172-2181, 2013. PubMed: 23637298
Waggoner JJ, et al. Single-reaction, multiplex, real-time rt-PCR for the detection, quantitation, and serotyping of dengue viruses. PLoS Negl. Trop. Dis. 7(4): e2116, 2013. PubMed: 23638191
Centers for Disease Control and Prevention (CDC). CDC DENV-1-4 Real-Time RT-PCR Assay for Detection and Serotype Identification of Dengue Virus. Instructions for Use Package Insert.