| Comments |
Restriction digests of the clone give the following sizes (kb): EcoRI--22.6, 10.5, 5.2, 3.6, 3.1, 2.45, 1.45, 0.96; EcoRI/HindIII--22.6, 10.5, 5.2, 3.6, 3.1, 2.45, 1.70, 1.45, 0.96. Verified to contain the correct insert sequence using the following oligonucleotides (5'-3'): GCCTCAATCCTTCAAATGCATGCTG and CTAGAGGATCTGAAGGCTTTCCCA. The predicted product size is (bp): 89. The observed product size is (bp): 89. |