Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Yes
AAGGATCATTAACGCGCCGTGGGGGGACGGGGCCCGATCGGGTTCCCCGACCCTCTCACCTGGCCACCCTTGTCTATCCTACCTGTTGCTTCGGCGGGCCTGCAGCGATGCTGCCGGGGGGGCTTGGCCTCCCGGGCTCGTGCCCGCCGGGGACACCGTTGAACTTCTGGTTCGGAGCTTTGACGTCTGAGACCCATCATAATCAGTGAAAACTTTCAACAACGGATCTCTTGGTTCCGACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCAAGCGCGGCTTGTGTGTTGGGCCCGCGTCCCCCCATGGACGTGCCCGAAAAGCAGCGGCGGCGTCGCGTTCCGGTGCCCGAGCGTATGGGGCTTCGTCACACGCTCTCAGAGGCCCGGCCGGCCCCGGCCCCCACTCATCGACCCCGGCGGGGGGGAAAGTAAGTCTTCTCTCGACATCTTCCCCTCTTCCGACCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG
CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCTCCTTTGGGGCCCGAGTTGTAATTTGTAGAGGATGCTTCGGGCGTGGCCGCGGTCTAAGTCCCCTGGAACGGGGCGTCGCAGAGGGTGAGAATCCCGTCTTCGGCCGGCCGGCCCCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGTCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCATGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGAGTCGGCCGCGGGGGCTCAGCGGGCACTTGTTGCCCGTGCACTCCCCCGTGGTCGGGCCAGCGTCGGTTTCGACGGCCGGTCAAAGGCCCCCGGAATGTGTCGCCTCTCGGGGCGTCTTATAGCCGGGGGTGCAATGCGGCCAGTCGGGACCGAGGAACGCGCTCCGGCACGGACGCTGGCTTAATGGTTGTAAGCGA
Nucleotide (GenBank) : AF148715 glucan synthase (FKS) gene, complete coding sequence
Nucleotide (GenBank) : U91560 heat shock protein 70 gene, hsp70, complete coding sequence
Nucleotide (GenBank) : ABKH00000000 Paracoccidioides lutzii Pb01, whole genome shotgun sequencing project
Teixeira Mde M, et al. Paracoccidioides lutzii sp. nov.: biological and clinical implications. Med Mycol 52: 19-28, 2014. PubMed: 23768243
Paes HC, et al. Characterisation of the heat shock factor of the human thermodimorphic pathogen Paracoccidioides lutzii. Fungal Genet Biol 48: 947-955, 2011. PubMed: 21708278
Desjardins CA, et al. Comparative genomic analysis of human fungal pathogens causing paracoccidioidomycosis. PLoS Genet 7: e1002345, 2011. PubMed: 22046142
Glenn AE, et al. Comparative genomic and phylogenetic investigation of the xenobiotic metabolizing arylamine N-acetyltransferase enzyme family. FEBS Lett 584: 3158-3164, 2010. PubMed: 20621844
Teixeira MM, et al. Phylogenetic analysis reveals a high level of speciation in the Paracoccidioides genus. Mol Phylogenet Evol 52: 273-283, 2009. PubMed: 19376249
Rosenblad MA, et al. Kinship in the SRP RNA family. RNA Biol. 6: 508-516, 2009. PubMed: 19838050
Theodoro RC, Bagagli E, Oliveira C. Phylogenetic analysis of PRP8 intein in Paracoccidioides brasiliensis species complex. Fungal Genet Biol 45: 1284-1291, 2008. PubMed: 18672080
Derengowski LS, et al. Upregulation of glyoxylate cycle genes upon Paracoccidioides brasiliensis internalization by murine macrophages and in vitro nutritional stress condition. Med Mycol 46: 125-134, 2008. PubMed: 18324491
Dantas AS, et al. Oxidative stress response in Paracoccidioides brasiliensis: assessing catalase and cytochrome c peroxidase. Mycol Res 112: 747-756, 2008. PubMed: 18499421
Fernandes L, et al. Transcriptional profile of ras1 and ras2 and the potential role of farnesylation in the dimorphism of the human pathogen Paracoccidioides brasiliensis. FEMS Yeast Res 8: 300-310, 2008. PubMed: 17927766
Pereira M, et al. Molecular cloning and characterization of a glucan synthase gene from the human pathogenic fungus Paracoccidioides brasiliensis. Yeast 16: 451-462, 2000. PubMed: 10705373
Cunha AF, et al. Identification, N-terminal region sequencing and similarity analysis of differentially expressed proteins in Paracoccidioides brasiliensis. Med. Mycol. 37: 115-121, 1999. PubMed: 10361267
Molinari-Madlum EE, et al. Virulence of Paracoccidioides brasiliensis isolates can be correlated to groups defined by random amplified polymorphic DNA analysis. Med. Mycol. 37: 269-276, 1999. PubMed: 10421862
da Silva SP, et al. Differential expression of an hsp70 gene during transition from the mycelial to the infective yeast form of the human pathogenic fungus Paracoccidioides brasiliensis. Mol. Microbiol. 31: 1039-1050, 1999. PubMed: 10096073
Salem-Izacc SM, et al. Protein synthesis patterns of Paracoccidioides brasiliensis isolates in stage-specific forms and during cellular differentiation. J. Med. Vet. Mycol. 35: 205-211, 1997.
Jesuino RS, et al. In vitro amphotericin B effects on growth, viability and dimorphism of Paracoccidioides brasiliensis: reversal of the treatment. Microbiol. Immunol. 41: 93-99, 1997. PubMed: 9087951
Mattar-Filho R, et al. Expression of glycoprotein gp43 in stage-specific forms and during dimorphic differentiation of Paraccidioides brasiliensis. J. Med. Vet. Mycol. 35: 341-345, 1997.
Soares CM, et al. Characterization of Paracoccidioides brasiliensis isloates by random amplified polymorphic DNA analysis. J. Clin. Microbiol. 33: 505-507, 1995. PubMed: 7714219
da Silva SP, et al. Phase transition and stage-specific protein synthesis in the dimorphic fungus Paracoccidioides brasiliensis. Exp. Mycol. 18: 294-299, 1994.
Celia M Soares, personal communication
Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009. PubMed: 19664262
Nicola AM, et al. The stress responsive and morphologically regulated hsp90 gene from Paracoccidioides brasiliensis is essential to cell viability. BMC Microbiol 8: 158, 2008. PubMed: 18808717
Carrero LL, et al. New Paracoccidioides brasiliensis isolate reveals unexpected genomic variability in this human pathogen. Fungal Genet Biol 45: 605-612, 2008. PubMed: 18364259
Bastos KP, et al. The transcriptome analysis of early morphogenesis in Paracoccidioides brasiliensis mycelium reveals novel and induced genes potentially associated to the dimorphic process. BMC Microbiol 7: 29-29, 2007. PubMed: 17425801
Bailao AM, et al. The transcriptional profile of Paracoccidioides brasiliensis yeast cells is influenced by human plasma. FEMS Immunol Med Microbiol 51: 43-57, 2007. PubMed: 17608708
Bailao AM, et al. Differential gene expression by Paracoccidioides brasiliensis in host interaction conditions: Representational difference analysis identifies candidate genes associated with fungal pathogenesis. Microbes Infect 8: 2686-2697, 2006. PubMed: 16962356
Andersen ES, et al. The tmRDB and SRPDB resources. Nucleic Acids Res. 34: D163-D168, 2006. PubMed: 16381838
Castro Nda S, et al. Screening for glycosylphosphatidylinositol-anchored proteins in the Paracoccidioides brasiliensis transcriptome. Genet Mol Res 4: 326-345, 2005. PubMed: 16110449
Felipe MS, et al. Transcriptional profiles of the human pathogenic fungus Paracoccidioides brasiliensis in mycelium and yeast cells. J Biol Chem 280: 24706-24714, 2005. PubMed: 15849188
Albuquerque P, et al. Pbhyd1 and Pbhyd2: two mycelium-specific hydrophobin genes from the dimorphic fungus Paracoccidioides brasiliensis. Fungal Genet Biol 41: 510-520, 2004. PubMed: 15050540
Felipe MS, et al. Transcriptome characterization of the dimorphic and pathogenic fungus Paracoccidioides brasiliensis by EST analysis. Yeast 20: 263-271, 2003. PubMed: 12557278
Izacc SM, et al. Molecular cloning, characterization and expression of the heat shock protein 60 gene from the human pathogenic fungus Paracoccidioides brasiliensis. Med Mycol 39: 445-455, 2001. PubMed: 12054056
Motoyama AB, et al. Molecular identification of Paracoccidioides brasiliensis by PCR amplification of ribosomal DNA. J Clin Microbiol 38: 3106-3109, 2000. PubMed: 10921990
