| 產品名稱 | Scheffersomyces stipitis (Pignal) Kurtzman et Suzuki |
|---|---|
| 商品貨號 | B176299 |
| Deposited As | Pichia stipitis Pignal |
| Strain Designations | CBS 6054 [CCRC 21777, IFO 10063, NRRL Y-11545] |
| Application | Bioethanol production |
| Biosafety Level | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format | freeze-dried |
| Storage Conditions | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain | no |
| Preceptrol® | no |
| Genome Sequenced Strain | Yes |
| Comments | Use of corn steep liquor in fermentation of D-xylose Genome sequencing strain (completed by the Joint Genome Institute at the Department of Energy, USA). |
| Morphology | On YM medium at 25°C after 2 days, colonies creamy white to dingy white, smooth, slightly raised, margin entire. Cells subglobose to ellipsoid, smooth, guttulate, 4-8 X 3-5 μm. |
| Medium | ATCC® Medium 200: YM agar or YM broth ATCC® Medium 1245: YEPD ATCC® Medium 28: Emmons' modification of Sabouraud's agar |
| Growth Conditions | Temperature: 24°C to 26°C
Atmosphere: Typical aerobic |
| Sequenced Data |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence
GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGTATTCTTTTTGCCAGCGCTTAACTGCGCGGCGAAAAAACCTTACACACAGTGTTTTCTTTATTAGAAACTATTGCTTTGGTCTGGCTCAGAAATGAGTTGGGCCAGAGGTTTACCAAACTTCAATTTTATTGAATTGTTATTTTATTAATTTGTCAATTTGTTGATTAAATTCAAAAATCTTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATATGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCCTCGGGTTTGGTATTGAGTGATACTCTTAGTCGAACTAGGCGTTTGCTTGAAAAGTATTGGCACGAGTGGTACTAAATAGTACTGACAGAATATTTCAATGTATTAGGTTTATCCAACTCGTTGAGACTTCTGGCGGTGAATTTTTGGTATATTGGCTTTGCCTTACAAAACAACAAACAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAA D1D2 region of the 26S ribosomal RNA gene ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTCAGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGTCTGATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGTTTGAGATCAGACTTGGTATTTTGTATGTCTTGCTTTCGGGTGGGGCCTCTACAGTTTACTGGGCCAGCATCGGTTTGGACGGTAGGATAATGACATTGGAATGTGGCACCACTTCGGTGGTGTGTTATAGACTTTGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTGACTAGGATGCTGGCATAATGATCTTAAACCGC |
| Name of Depositor | CBS |
| Chain of Custody | ATCC <-- CBS <-- J Santa Maria |
| Cross References | Nucleotide (GenBank) : KU729088 ITS including 5.8S rRNA gene Nucleotide (GenBank) : KU729191 D1/D2 region of 28S rRNA gene Nucleotide (GenBank) : CM000437 Pichia stipitis CBS 6054 chromosome 1, whole genome shotgun sequence. Nucleotide (GenBank) : AAVQ00000000 Scheffersomyces stipitis CBS 6054 chromosome 1, whole genome shotgun sequencing project Nucleotide (GenBank) : AF030426 nucleotide sequence of PsCYC1 Nucleotide (GenBank) : U08628 Pichia stipitis CBS 6054 ATCC 58785 autonomous replication Nucleotide (GenBank) : U08629 Pichia stipitis CBS 6054 ATCC 58785 orotidine-5'-phosphate Nucleotide (GenBank) : AF127801 Pichia stipitis xylitol dehydrogenase (XYL2) gene, complete cds. |
| References | Toivola A, et al. Alcoholic fermentation of D-xylose by yeasts. Appl. Environ. Microbiol. 47: 1221-1223, 1984. Deed RW, et al. Xylitol production by recombinant Saccharomyces cerevisiae. Bio-Technology 9: 1090-1095, 1991. PubMed: 1367625 Amartey S, Jeffries TW. Comparison of corn steep liquor with other nutrients in the fermentation of D-Xylose by Pichia stipitis CBS 6054. Biotechnol. Lett. 16: 211-214, 1994. Shi NQ, et al. Disruption of the cytochrome c gene in xylose-utilizing yeast Pichia stipitis leads to higher ethanol production. Yeast 15: 1021-1030, 1999. PubMed: 10455226 Jeffries TW, et al. Genome sequence of the lignocellulose-bioconvertingand xylose-fermenting yeast Pichia stipitis. Nat. Biotech. 25: 319-326, 2007. PubMed: 17334359 Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009. PubMed: 19664262 Rosenblad MA, et al. Kinship in the SRP RNA family. RNA Biol. 6: 508-516, 2009. PubMed: 19838050 Taylor DJ, Bruenn J. The evolution of novel fungal genes from non-retroviral RNA viruses. BMC Biol. 7: 88, 2009. PubMed: 20021636 Andersen ES, et al. The tmRDB and SRPDB resources. Nucleic Acids Res. 34: D163-D168, 2006. PubMed: 16381838 Shi NQ, et al. SHAM-sensitive alternative respiration in the xylose-metabolizing yeast Pichia stipitis. Yeast 19: 1203-1220, 2002. PubMed: 12271457 Jin YS, et al. Molecular cloning of XYL3 (D-xylulokinase) from Pichia stipitis and characterization of its physiological function. Appl. Environ. Microbiol. 68: 1232-1239, 2002. PubMed: 11872473 Shi NQ, et al. Characterization and complementation of a Pichia stipitis mutant unable to grow on D-xylose or L-arabinose. Appl. Biochem. Biotechnol. Spring 84-86: 201-216, 2000. PubMed: 10849789 |
| 梅經理 | 17280875617 | 1438578920 |
| 胡經理 | 13345964880 | 2438244627 |
| 周經理 | 17757487661 | 1296385441 |
| 于經理 | 18067160830 | 2088210172 |
| 沈經理 | 19548299266 | 2662369050 |
| 李經理 | 13626845108 | 972239479 |
