Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Yes
ATTGTTCGCCTAGACGCTCTCTTCTTATCGATAACGTTCCAATACGCTCAGTACAAAAAAGATTAGCCGCAGTTGGTAAAACCTAAAACGACCGTACTTGCATTATACCTCAAGCACGCAGAGAAACCTCTCTTTGGAAAAAAAACATCCAATGAAAAGGCCAGCAATTTCAAGTTAACTCCAAAGAGTATCACTCACTACCAAACAGAATGTTTGAGAAGGAAATGACGCTCAAACAGGCATGCCCCCTGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGGAATTCTGCAATTCACATTACGTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTTAATATTTTTAAAATTTCCAGTTACGAAAATTCTTGTTTTTGACAAAAATTTAATGAATAAATAAAATTGTTTGTGTTTGTTACCTCTGGGCCTCGATTGCTCGAATGCCCAAAGAAAAAGTTGCAAAGATATGAAAACTCCACAGTGTGTTGTATTGAAACGGTTTTAATTGTCCTATAACAATAGCACAGAAATCTCTCACCGTTTGGAATAGCAAGAAAGAAACTTACAAGCCAAGCAAGACCGCGCACTTAAGCGCAGGCCCGACTGGACTCTCCATCTCTTGTCTTCTTGCCCAGTAAAAGCTCTCATGCTCCTGCCAAAACAAAAAAATCCATT
Nucleotide (GenBank) : JQ070083 ITS including 5.8S rRNA gene
Nucleotide (GenBank) : AABY00000000 Saccharomyces paradoxus NRRL Y-17217, whole genome shotgun sequencing project
McCullough MJ, et al. Intergenic transcribed spacer PCR ribotyping for differentiation of Saccharomyces species and interspecific hybrids. J Clin Microbiol 36: 1035-1038, 1998. PubMed: 9542932
Kellis M, et al. Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423: 241-254, 2003.
Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009. PubMed: 19664262
Ganley AR, Kobayashi T. Highly efficient concerted evolution in the ribosomal DNA repeats: total rDNA repeat variation revealed by whole-genome shotgun sequence data. Genome Res. 17: 184-191, 2007. PubMed: 17200233
Liti G, Barton DBH, Louis EJ. Sequence diversity, reproductive isolation and species concepts in Saccharomyces. Genetics 174: 839-850, 2006. PubMed: 16951060
Kurtzman CP, et al. Multigene phylogenetic analysis of pathogenic Candida species in the Kazachstania (Arxiozyma) telluris complex and description of their ascosporic states as Kazachstania bovina sp. nov., K. heterogenica sp. nov., K. pintolopesii sp. nov., and K. slooffiae sp. nov. J. Clin. Microbiol. 43: 101-111, 2005. PubMed: 15634957
Dandjinou AT, et al. A phylogenetically based secondary structure for the yeast telomerase RNA. Curr Biol 14: 1148-1158, 2004. PubMed: 15242611
Smit MS. Fungal epoxide hydrolases: new landmarks in sequence-activity space. Trends Biotechnol 22: 123-129, 2004. PubMed: 15036862
Johnson LJ, et al. Population genetics of the wild yeast Saccharomyces paradoxus. Genetics 166: 43-52, 2004. PubMed: 15020405
Van Nues RW, Brown JD. Saccharomyces SRP RNA secondary structures: a conserved S-domain and extended Alu-domain. RNA 10: 75-89, 2004. PubMed: 14681587
Kurtzman CP, Robnett CJ. Phylogenetic relationships among yeasts of the 'Saccharomyces complex' determined from multigene sequence analyses. FEMS Yeast Res 3: 417-432, 2003. PubMed: 12748053
Kodama T, et al. Isolation and characterization of the HO gene from the yeast Saccharomyces paradoxus. FEMS Yeast Res. 4: 51-57, 2003. PubMed: 14554196
Goddard MR, Burt A. Recurrent invasion and extinction of a selfish gene. Proc Natl Acad Sci USA 96: 13880-13885, 1999. PubMed: 10570167
Groth C, Hansen J, Piskur J. A natural chimeric yeast containing genetic material from three species. Int. J. Syst. Bacteriol. 49: 1933-1938, 1999. PubMed: 10555378
Montrocher R, et al. Phylogenetic analysis of the Saccharomyces cerevisiae group based on polymorphisms of rDNA spacer sequences. Int. J. Syst. Bacteriol. 48: 295-303, 1998. PubMed: 9542100
Oda Y, et al. A phylogenetic analysis of Saccharomyces species by the sequence of 18S-28S rRNA spacer regions. Yeast 13: 1243-1250, 1997. PubMed: 9364748
