| 產品名稱 | Glarea lozoyensis Bills et Pelaez |
|---|---|
| 商品貨號 | B195360 |
| Deposited As | Zalerion arboricola Buczacki |
| Strain Designations | MF5171 |
| Application | Produces antifungal agents Produces pneumocandin complex |
| Biosafety Level | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format | frozen |
| Storage Conditions | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain | yes |
| Disclosure | This material is cited in a US or other Patent and may not be used to infringe the claims. Depending on the wishes of the Depositor, ATCC may be required to inform the Patent Depositor of the party to which the material was furnished. This material may not have been produced or characterized by ATCC. |
| Preceptrol® | no |
| Genome Sequenced Strain | Yes |
| Comments | Taxonomic revision Genome sequencing strain (Institute of Microbiology, Chinese Academy of Sciences, China) |
| Morphology | Colonies on PDA are attaining 60-62 mm diam. in 4 weeks. Mature colonies are effuse, with submerged and aerial hyphae, surface hairly, lanose, or funiculose, dull to moderately shiny; colony color is pale pinkish buff. |
| Medium | ATCC® Medium 200: YM agar or YM broth ATCC® Medium 336: Potato dextrose agar (PDA) ATCC® Medium 337: Potato, dextrose, yeast agar (PDY) |
| Growth Conditions | Temperature: 24°C to 26°C Atmosphere: Typical aerobic |
| Sequenced Data |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGTGTTCCCTGCCCTCGCGGGTAGAAACGCCCACCCTTGTGTAATATATCATGTTGCTTTGGCAGGCCGCCCTCGGGCACCGGCTCCGGCCGGGTCGCGCCTGCCAGAGGACCCCAAACTCTGAATGTTAGTGTCGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTCGAGCGTCATTTAAACCAATCCAGCTTGCTGGGTCTTGGGCTCTCGCCTCCGGGCGGGCCTTAAAATCAGTGGCGGCGCCACCCGGCTCTAAGCGTAGTAATACTCCTCGCTACAGGGCTCCGGGTGGAGGCTGGCCAACAACCCCCAATTTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATA |
| Name of Depositor | Merck & Co., Inc. |
| U.S. Patent Number | |
| Isolation | Pond water, Valle del Rio Lozoya, Spain |
| Cross References | Nucleotide (GenBank) : U33266 Zalerion arboricola pyrroline carboxylate reductase (P5CR) mRNA, Nucleotide (GenBank) : ALVE00000000 Glarea lozoyensis ATCC 20868, whole genome shotgun sequencing project |
| References | Shinohara C, et al. Gypsetin, a new inhibitor of acyl-CoA:cholesterol acyltransferase produced by Nannizzia gypsea var. incurvata IFO 9228. I. Fermentation, isolation, physico-chemical properties and biological activity. J. Antibiot. 47: 163-167, 1994. PubMed: 8150711 Nuber B, et al. Gypsetin, a new inhibitor of acyl-CoA:cholesterol acyltransferase produced by Nannizzia gypsea var. incurvata IFO 9228. II. Structure determination. J. Antibiot. 47: 168-172, 1994. PubMed: 8150712 Giacobbe RA, et al. Antifungal fermentation product. US Patent 4,931,352 dated Jun 5 1990 Giacobbe RA, et al. Antibiotic agent produced by the cultivation of Zalerion microorganism in the presence of mannitol. US Patent 5,021,341 dated Jun 4 1991 Masurekar PS, et al. Pneumocandins from Zalerion arboricola. II. Modification of productspectrum by mutation and medium manipulation. J. Antibiot. 45: 1867-1874, 1992. PubMed: 1490877 Schwartz RE, et al. Pneumocandins from Zalerion arboricola. I. Discovery and isolation. J. Antibiot. 45: 1853-1866, 1992. PubMed: 1490876 Giacobbe RA, et al. Process for antifungal fermentation product. US Patent 4,968,608 dated Nov 6 1990 Fujimori F, Okuda T. Application of the random amplified polymorphic DNA using the polymerase chain reaction for efficient elimination of duplicate strains in microbial screening I. Fungi. J. Antibiot. 47: 173-182, 1994. PubMed: 8150713 Hensens OD, et al. Pneumocandins from Zalerion arboricola. III. Structure elucidation. J. Antibiot. 45: 1875-1885, 1992. PubMed: 1490878 Schmatz DM, et al. Pneumocandins from Zalerion arboricola. IV. Biological evaluation of natural and semisynthetic pneumocandins for activity against Pneumocystis carinii and Candida species. J. Antibiot. 45: 1886-1891, 1992. PubMed: 1490879 Adefarati AA, et al. Pneumocandins from Zalerion arboricola. V. Glutamic acid- and leucine-derived amino acids in pneumocandin A0 (L-671,329) and distinct origins of the substituted proline residues in pneumocandins A0 and B0. J. Antibiot. 45: 1953-1957, 1992. PubMed: 1362720 Bills GF, et al. Reclassification of a pneumocandin-producing anamorph, Glarea lozoyensis gen. et sp. nov., previously identified as Zalerion arboricola. Mycol. Res. 103: 179-192, 1999. Lu P, et al. A gene (pks2) encoding a putative 6-methylsalicylic acid synthase from Glarea lozoyensis. Mol Genet Genomics 273: 207-216, 2005. PubMed: 15800788 Zhang A, et al. Efficient disruption of a polyketide synthase gene ( pks1) required for melanin synthesis through Agrobacterium-mediated transformation of Glarea lozoyensis. Mol Genet Genomics 268: 645-655, 2003. PubMed: 12589439 |
| 梅經理 | 17280875617 | 1438578920 |
| 胡經理 | 13345964880 | 2438244627 |
| 周經理 | 17757487661 | 1296385441 |
| 于經理 | 18067160830 | 2088210172 |
| 沈經理 | 19548299266 | 2662369050 |
| 李經理 | 13626845108 | 972239479 |
