Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
GGAAGGATCATTACTGATTTGCTTAATTGCACCACATGTGTTTTTCACTGGACAGCTGCTTTGGCGGGGGGACTCGTTTCCGCCGCCAGAGGTCACAACTAAACCAAACTTTTTATTACCAGTCAACCATACGTTTTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGCGTCATTTCTCCCTCAAGCCCGCGGGTTTGGTGTTGAGCAATACGCCAGGTTTGTTTGAAAGACGTACGTGGAGACTATATTAGCGACTTAGGTTCTACCAAAACGCTTGTGCAGTCGGCCCACCACAGCTTTTCTAACTTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA
ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCTGGCTCTTGTCTATGTTTCTTGGAACAGAACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGACCCAGGTCCGTGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGCATTTTGCATGTTGCTTCTTCGGGGGCGGCCTCTGCGGTTTGTCGGGCCAGCATCAGTTTGGGCGG
Nucleotide (GenBank) : X05604 Candida tropicalis mRNA for catalase.
Nucleotide (GenBank) : M18832 C.tropicalis peroxisomal catalase mRNA, complete cds.
Nucleotide (GenBank) : AB025647 nucleotide sequence of the promoter region of CT-T3A
Nucleotide (GenBank) : AB025648 nucleotide sequence of the promoter region of CT-T3B
Nucleotide (GenBank) : M18259 C.tropicalis POX2 gene encoding PXP-2 protein, complete cds.
Nucleotide (GenBank) : M12161 Candida tropicalis acyl-coenzyme A oxidase I precursor, gene,
Nucleotide (GenBank) : S77426 ICL=isocitrate lyase gene {promoter} [Candida tropicalis, pK233,
Nucleotide (GenBank) : M24440 Candida tropicalis (ATCC 20336)small aleate-inducible peroxisomal
Nucleotide (GenBank) : M12160 Yeast (C.tropicalis) POX4 gene encoding acyl-coenzyme A oxidase II
Nucleotide (GenBank) : KU729067 ITS including 5.8S rRNA gene
Nucleotide (GenBank) : KU729150 D1/D2 region of 28S rRNA gene
Eirich LD, et al. Cloning and characterization of three fatty alcohol oxidase genes from Candida tropicalis strain ATCC 20336. Appl Environ Microbiol 70: 4872-4879, 2004. PubMed: 15294826
Torkko JM, et al. Candida tropicalis expresses two mitochondrial 2-enoyl thioester reductases that are able to form both homodimers and heterodimers. J Biol Chem 278: 41213-41220, 2003. PubMed: 12890667
Kamauchi S, et al. Structurally and functionally conserved domains in the diverse hydrophilic carboxy-terminal halves of various yeast and fungal Na+/H+ antiporters (Nha1p). J. Biochem. 131: 821-831, 2002. PubMed: 12038978
Kato M, et al. Phylogenetic relationship and mode of evolution of yeast DNA topoisomerase II gene in the pathogenic Candida species. Gene 272: 275-281, 2001. PubMed: 11470534
Kanai T, et al. An n-alkane-responsive promoter element found in the gene encoding the peroxisomal protein of Candida tropicalis does not contain a C(6) zinc cluster DNA-binding motif. J Bacteriol 182: 2492-2497, 2000. PubMed: 10762250
Kanayama N, et al. Comparison of molecular structures and regulation of biosynthesis of unique thiolase isozymes localized only in peroxisomes of n-alkane-utilizable yeast, Candida tropicalis.. J Ferment Bioeng 78: 273-278, 1994.
Kemp GC, et al. Activity and substrate specificity of the fatty alcohol oxidase of Candida tropicalis in organic solvents. Appl Microbiol Biotechnol 34: 441-445, 1991.
Okamoto H, et al. Degradation of peroxisomal catalase in an N alkane-utilizable yeast Candida tropicalis. J Ferment Bioeng 72: 254-257, 1991.
Kemp GD, et al. Light sensitivity of the n-alkane-induced fatty alcohol oxidase from Candida tropicalis and Yarrowia lipolytica. Appl Microbiol Biotechnol 32: 461-464, 1990.
Tanak A, et al. Production of uricase by Candida tropicalis using n-alkane as a substrate. Appl Environ Microbiol 34: 342-346, 1977. PubMed: 200173
Kemp GD, et al. Inducible long chain alcohol oxidase from alkane-grown Candida tropicalis. Appl Microbiol Biotechnol 29: 370-374, 1988.
Tarasova NV, et al. Method for preparing ergosterol and ubiquinone-9 in a single process. US Patent 3,965,130 dated Jun 22 1976
Miura Y. Recycle type, continuous process for fermentation based on application of mixed culturing principle. US Patent 3,767,534 dated Oct 23 1974
Ueda M, et al. Characterization of peroxisomes in an N alkane-utilizable yeast Candida tropicalis grown on glucose and propionate. J Ferment Bioeng 68: 411-416, 1989.
Ueda M, et al. Peroxisomal localization of enzymes related to fatty acid beta-oxidation in an n-alkane-grown yeast, Candida tropicalis. Agric Biol Chem 49: 1821-1828, 1985.
Ueda M, et al. Peroxisomal and mitochondrial carnitine acetyltransferases in alkane-grown yeast Candida tropicalis. Eur J Biochem 124: 205-210, 1982. PubMed: 7084226
Teranishi Y, et al. Induction of catalase activity by hydrocarbons in Candida tropicalis pK 233. Agric Biol Chem 38: 1221-1225, 1974.
Teranishi Y, et al. Catalase activities of hydrocarbon-utilizing Candida yeasts. Agric Biol Chem 38: 1213-1220, 1974.
Uejima Y, et al. Production of extracellular mannan by Candida tropicalis Pk 233. Trans Mycol Soc Jpn 27: 481-486, 1986.
Torkko JM, et al. Candida tropicalis Etr1p and Saccharomyces cerevisiae Ybr026p (Mrf1'p), 2-enoyl thioester reductases essential for mitochondrial respiratory competence. Mol. Cell Biol. 21: 6243-6253, 2001. PubMed: 11509667
