Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Yes
GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCACCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCATTCATGGCCGCCGGGGGCTCTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCTGTCTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGGACGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAATCAATCTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA
ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGCATTGTAATTTGCAGAGGATGCTTCGGGTGCGGCCCCTGTCTAAGTGCCCTGGAACGGGCCGTCAGAGAGGGTGAGAATCCCGTCTGGGATGGGGTGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCTCCAGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCTGGGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCTCCCGGAATGTAGTGCCCTCCGGGGCACCTTATAGCCGGGAGTGCAATGCGGCCAGCCTGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCATAATGGTCGTAAACGAC
Nucleotide (GenBank) : KU729047 ITS including 5.8S rRNA gene
Nucleotide (GenBank) : KU729135 D1/D2 region of 28S rRNA gene
Nucleotide (GenBank) : D63941 Aspergillus oryzae enoA gene for enolase, complete cds. enolase (= phophopyruvate hydratase) gene, enoA
Nucleotide (GenBank) : E03046 DNA sequence coding for glyceraldehyde-3-phosphate dehydrogenase derived from Aspergillus oryzae.
Nucleotide (GenBank) : JZJM00000000 Aspergillus oryzae RIB40, whole genome shotgun sequencing project
Gomi K, et al. Cloning and nucleotide sequence of the acid protease-encoding gene (pepA) from Aspergillus oryzae. Biosci. Biotechnol. Biochem. 57: 1095-1100, 1993. PubMed: 7763981
Gomi K, et al. Cloning and molecular characterization of the acetamidase-encoding gene (amdS) from Aspergillus oryzae. Gene 108: 91-98, 1991. PubMed: 1840550
Machida M, et al. Molecular cloning of a genomic DNA for enolase from Aspergillus oryzae. Biosci. Biotechnol. Biochem. 60: 161-163, 1996. PubMed: 8824839
Tada S, et al. Cloning and nucleotide sequence of the genomic Taka-amylase A gene of Aspergillus oryzae. Agric. Biol. Chem. 53: 593-599, 1989.
Nagashima T, et al. Site-directed mutagenesis of catalytic active-site residues of Taka-amylase A. Biosci. Biotech. Biochem. 56: 207-210, 1992.
Razzaque A, Ueda S. Glucoamylase of Aspergillus oryzae. J. Ferment. Technol. 56: 296-302, 1978.
Machida M, et al. Genome sequencing and analysis of Aspergillus oryzae. Nature 438: 1157-1161, 2005.
Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009. PubMed: 19664262
Akao T, et al. Analysis of expressed sequence tags from the fungus Aspergillus oryzae cultured under different conditions. DNA Res. 14: 47-57, 2007. PubMed: 17540709
Ito K, Hanya Y, Koyama Y. Purification and characterization of a glutaminase enzyme accounting for the majority of glutaminase activity in Aspergillus sojae under solid-state culture. Appl. Microbiol. Biotechnol. 97: 8581-8590, 2013. PubMed: 23339014
Kuprys PV, et al. Identification of telomerase RNAs from filamentous fungi reveals conservation with vertebrates and yeasts. PLoS One 8: e58661, 2013. PubMed: 23555591
Yanagisawa S, Kikuma T, Kitamoto K. Functional analysis of Aoatg1 and detection of the Cvt pathway in Aspergillus oryzae. FEMS Microbiol Lett 338: 168-176, 2013. PubMed: 23136971
Akao T, et al. Lack of endoplasmic reticulum 1,2-alpha-mannosidase activity that trims N-glycan Man9GlcNAc2 to Man8GlcNAc2 isomer B in a manE gene disruptant of Aspergillus oryzae. J. Biosci. Bioeng. 113: 438-441, 2012. PubMed: 22169093
Ogawa M, Kobayashi T, Koyama Y. ManR, a novel Zn(II)2Cys6 transcriptional activator, controls the beta-mannan utilization system in Aspergillus oryzae. Fungal Genet. Biol. 49: 987-995, 2012. PubMed: 23063954
Marui J, et al. Enzymatic properties of the glycine D-alanine [corrected] aminopeptidase of Aspergillus oryzae and its activity profiles in liquid-cultured mycelia and solid-state rice culture (rice koji). Appl. Microbiol. Biotechnol. 93: 655-669, 2012. PubMed: 22005737
Joardar V, et al. Sequencing of mitochondrial genomes of nine Aspergillus and Penicillium species identifies mobile introns and accessory genes as main sources of genome size variability. BMC Genomics 13: 698, 2012. PubMed: 23234273
Kikuma T, Kitamoto K. Analysis of autophagy in Aspergillus oryzae by disruption of Aoatg13, Aoatg4, and Aoatg15 genes. FEMS Microbiol. Lett. 316: 61-69, 2011. PubMed: 21204928
Tokunaga C, Saitoh C, Kitamoto K. Cloning of Aspergillus oryzae Aovps5 gene, homologous to vacuolar protein sorting associated gene VPS5 and construction of the disruptant. J. Biosci. Bioeng. 108: 121-123, 2009. PubMed: 19619858
Ogasawara H, et al. Crawler, a novel Tc1/mariner-type transposable element in Aspergillus oryzae transposes under stress conditions. Fungal Genet. Biol. 46: 441-449, 2009. PubMed: 19269345
Higuchi Y, et al. Endocytosis is crucial for cell polarity and apical membrane recycling in the filamentous fungus Aspergillus oryzae. Eukaryot. Cell 8: 37-46, 2009. PubMed: 19028995
Escano CS, et al. Disruption of the Aopex11-1 gene involved in peroxisome proliferation leads to impaired Woronin body formation in Aspergillus oryzae. Eukaryot. Cell 8: 296-305, 2009. PubMed: 19136573
Shima Y, et al. Identification of three mutant loci conferring carboxin-resistance and development of a novel transformation system in Aspergillus oryzae. Fungal Genet. Biol. 46: 67-76, 2009. PubMed: 18992352
