| 產(chǎn)品名稱(chēng) |
HHCPF54 |
| 商品貨號(hào) |
B213103 |
| Designations |
HHCPF54 |
| GenBank Number |
M78093
|
| Species |
Homo sapiens, human |
| Applications |
The predicted product size is (bp): 142. The observed product size(s) is(are) (bp): 284 (human). |
| Vector |
Construct size (kb): 4.400000095367432 DESCRIPTION OF VECTOR COMPONENT:
Name of vector: pBluescript SK-
Intact vector size: 2.960
Type of vector: phagemid
Vector end: EcoRI
Vector end: EcoRI
Cloning sites: KpnI ApaI DraII XhoI (SalI HincII AccI) ClaI HindIII EcoRV
EcoRI PstI SmaI BamHI SpeI XbaI EagI NotI SacII BstXI SacI
Polylinker sites: SacI BstXI SacII NotI EagI XbaI SpeI BamHI SmaI PstI EcoRI
EcoRV HindIII (ClaI Bsp106I) (HincII AccI SalI) XhoI
(Eco0109I DraII ApaI) KpnI
Construction: pUC19
Host range: Escherichia coli
Features (with orientation and position when available):
replicon: f1, ->
insert detection: lacZ', <-
primer site: M13-20, ->
promoter: T7, ->
MCS: KpnI...SacI, ->
promoter: T3, <-
promoter: lac, <-
primer site: M13 reverse, <-
replicon: pMB1
marker(s): ampR, <-
Cross references: |
| Insert |
DNA: cDNA DESCRIPTION OF INSERT COMPONENT:
Genome: Homo sapiens
Gene symbol: D15S180E
Genomic copy number: unique
Gene name: DNA Segment, single copy, expressed
Contains complete coding sequence?: U
Sequence homology: Homo sapiens microtubule-associated protein-5
Chromosome: 15; Localization: 15 q15(21.1)-q22
Tissue: hippocampus, female, 2 years, oligo-dT and random primed
(Stratagene 936205), subtracted
Type of DNA: cDNA
Insert end: Modification: EcoRI linkers
Insert end: Modification: EcoRI linkers
Insert size (kb): 1.4
Cross references: DNA Seq. Acc.: M78093; EST: EST01683; Primer: M13 Forward Insert lengths(kb): 1.399999976158142 Tissue: hippocampus, female, 2 years, oligo-dT and random primed (Stratagene 936205), subtracted Gene product: microtubule-associated protein-5 [Mtap5] |
| Insert Size (kb) |
1.400 |
| Biosafety Level |
1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Shipping Information |
Distributed: DNA (dried). Rehydrate with TE. (amount: 200 ng) |
| Comments |
Restriction digests of the clone give the following sizes (kb): EcoRI--3.0, 1.4; BamHI--4.2, 0.2; PstI--3.2, 0.75, 0.5; HindIII--4.4. EST01683 can be detected in genomic DNA using the following oligonucleotides (5'-3'): GTCCAAAGGCCTAGTCAATG and ACGGAAGAAGTCAAGGTCAG. EST01683 matches PIR accession A33645 with 62% identity and 80% similarity over the sequence range: 195-344. This sequence record is for mouse microtubule associated protein 1b (Mtap-1b). The predicted product size is (bp): 142. The observed product size(s) is(are) (bp): 284 (human). These primers appear to amplify across an intron approximately 140 bp in size that occurs near nt 185 of GENBANK file HUMXT01683. |
| References |
Adams MD, et al. Sequence identification of 2,375 human brain genes. Nature 355: 632-634, 1992. PubMed: 1538749
Maglott DR, et al259 human brain expressed sequence tags (ESTs): chromosome localization, subregional assignment, and sequence analysisIn: Maglott DR, et alIdentification of transcribed sequencesNew YorkPlenum Presspp. 273-288, 1994
J C Venter, personal communication
|
