This material is cited in a US or other Patent and may not be used to
infringe the claims. Depending on the wishes of the Depositor, ATCC may be
required to inform the Patent Depositor of the party to which the material was
furnished. This material may not have been produced or characterized by ATCC.
Restriction digests of the clone give the following sizes (kb): EcoRI--5.8; BamHI--3.7, 2.1; NcoI--5.8.
Shuttle expression vector producing fusion proteins with human SOD (after Gln154 of SOD). Expression is regulated by the ADH2 UAS.
Constructed from pYASI1 by replacing the met-proinsulin sequence immediately downstream of Gln154 of the human SOD coding sequence with an EcoRI-containing adaptor: 5'AATTTGGGAATTCCATAATTAATTAAG3' /3'ACCCTTAAGGTATTAATTAATTCAGCT5'.
Media
ATCC® Medium 1227: LB Medium (ATCC medium 1065) with 50 mcg/ml ampicillin
Growth Conditions
Temperature: 37.0°C
References
Houghton M, et al. Hepatitis C virus protease. US Patent 5,371,017 dated Dec 6 1994
Cousens LS, et al. High level expression of proinsulin in the yeast, Saccharomyces cerevisiae. Gene 61: 265-275, 1987. PubMed: 3328732
