<menuitem id="ldf69"></menuitem>
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGAATTGCTCTCTGAGCGTTAAACTATATCCATCTACACCTGTGAACTGTTGATTGACTTCGGTCGATTACTTTTACAAACATTGTGTAATGAACGTCATGTTATTATAACAAAAATAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAACTTGCGCTCTCTGGTATTCCGGAGAGCATGCCTGTTTGAGTATCATGAAATCTCAACCATTAGGGTTTCTTAATGGCTTGGATTTGGGCGCTGCCACTTGCCTGGCTCGCCTTAAAGGAGTTAGCGTATTAACTTGTCGATCTGGCGTAATAAGTTTCGCTGGTGTAGACTTGAGAAGTGCGCTTCTAATCGTCCTCGGACAATTCTTGAACTCTGGTCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA
ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCTTAGTAACGGCGAGTGAACCGGGAAAAGCTCAAATTTGTAATCTGGCTGTCTTCGATAGTCCGAGTTGTAATCTATAGACGTGTTTTCCGTGCTGGACCGTATCTAAGTCCCTTGGAACAGGGTATCAAAGAGGGTGACAATCCCGTGCTTGATACGACCACCAGTGCTCTGTGATACACGCTCTACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGTTCTTTGGATTCAGCTAGTTCTTCTAGTCTACTTCCATTGAACGGGTCAACATCAGTTTTGTCCGGTGGATAAAGATAGTAGGAATGTAGCTCCCTCGGGAGTGTTATAGACTATTATTGCATACACTGGGTGAGACTGAGGACTGCAGCTCGCCTTTTGGCCGGTCTTCGGACACGTTCGAGCTTAGGATGTTGACATAATGGCTTTAAACGAC
Nucleotide (GenBank) : KM821090 D1/D2 region of 26S rRNA gene
Nucleotide (GenBank) : KM821111 ITS including 5.8S rRNA gene
Nucleotide (GenBank) : KM821100 26S-5S ribosomal RNA intergenic spacer (IGS)
Gueho E, et al. Contributions to a revision of the genus Trichosporon. Antonie van Leeuwenhoek 61: 289-316, 1992. PubMed: 1497334
Fell JW, et al. Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int. J. Syst. Evol. Microbiol. 50: 1351-1371, 2000. PubMed: 10843082
Suh SO, et al. Characterization of medically important yeast Trichosporon mucoides and its close sister Trichosporon dermatis by traditional and advanced technologies. J. Med. Microbiol. 64: 1135–1143, 2015. PubMed: 26296931
Hamano K, et al. Genome profiling (GP) as an effective tool for monitoring culture collections: A case study with Trichosporon. J. Microbiol Methods 89: 119-128, 2012. PubMed: 22401825
Chagas-Neto TC, et al. Bloodstream infections due to Trichosporon spp.: species distribution, Trichosporon asahii genotypes determined on the basis of ribosomal DNA intergenic spacer 1 sequencing, and antifungal susceptibility testing. J. Clin. Microbiol. 47: 1074-1081, 2009. PubMed: 19225102
Sugita T, et al. Sequence analysis of the ribosomal DNA intergenic spacer 1 regions of Trichosporon species. J. Clin. Microbiol. 40: 1826-1830, 2002. PubMed: 11980969
Scorzetti G, et al. Systematics of basidiomycetous yeasts: a comparison of large subunit D1/D2 and internal transcribed spacer rDNA regions. FEMS Yeast Res. 2: 495–517, 2002. PubMed: 12702266
Biswas SK, et al. Molecular phylogenetics of the genus Rhodotorula and related basidiomycetous yeasts inferred from the mitochondrial cytochrome b gene. Int. J. Syst. Evol. Microbiol. 51: 1191-1199, 2001. PubMed: 11411687
Sugita T, et al. Identification of medically relevant Trichosporon species based on sequences of internal transcribed spacer regions and construction of a database for Trichosporon identification. J. Clin. Microbiol. 37: 1985-1993, 1999. PubMed: 10325360
Fell JW, Roeijmans H, Boekhout T. Cystofilobasidiales, a new order of basidiomycetous yeasts. Int. J. Syst. Bacteriol. 49: 907-913, 1999. PubMed: 10319517
Sugita T, Nakase T. Molecular phylogenetic study of the basidiomycetous anamorphic yeast genus Trichosporon and related taxa based on small subunit ribosomal DNA sequences. Mycoscience 39: 7-13, 1998.
Liu XZ, et al. Towards an integrated phylogenetic classification of the Tremellomycetes. Stud. Mycol. 81: 85-147, 2015. PubMed: 26955199
<dfn id="yl0an"></dfn>
