Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Yes

Gaillardin CM, et al. A study of copulation, sporulation and meiotic segregation in Candida lipolytica. Arch. Mikrobiol. 92: 69-83, 1973. PubMed: 4725824 TTGATTTTATCTATTTCTGTGGATTTCTGGTATATTACAGCGTCATTTTATCTCAATTATAACTATCAACAACGGATCTCTTGGCTCTCACATCGATGAAGAACGCAGCGAACCGCGATATTTTTTGTGACTTGCAGATGTGAATCATCAATCTTTGAACGCACATTGCGCGGTATGGCATTCCGTACCGCACGGATGGAGGAGCGTGTTCCCTCTGGGATCGCATTGCTTTCTTGAAATGGATTTTTTTAAACTCTCAATTATTACGTCATTTCACCTCC
ACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAACCCTCGGGATTGTAATTTGAAGATTTGGCATTGGAGAAAGCTAACCCAAGTTGCTTGGAATAGTACGTCATAGAGGGTGACAACCCCGTCTGGCTAACCGTTCTCCATGTATTGCCTTATCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAACTCCATCTAAAGCTAAATACTGGTGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGGTGAAAAGAACTTTGAAAAGAGAGTGAAATAGTATGTGAAATTGTTGATAGGGAAGGAAATGAGTGGAGAGTGGCCGAGGTTTCAGCCGCCCCTCGTGGGCGGTGTACTGCCGACGCCGAGTCATCGATAGCGAGACGAGGGTTACAAATGGGAGCGCCTTCGGGCGTTCTCCCCTAACCCTCCACACTGCCACCGACGACATAAT
Nucleotide (GenBank) : KU729095 ITS including 5.8S rRNA gene
Nucleotide (GenBank) : X65225 Y.lipolytica PHO2 gene for acid phosphatase.
Nucleotide (GenBank) : AJ006754 Yarrowia lipolytica URA5-SEC65 gene region.
Nucleotide (GenBank) : Z34956 Y.lipolytica HOY1 gene for DNA-binding protein.
Nucleotide (GenBank) : Z49114 Y.lipolytica LYS1 gene for homocitrate synthase.
Nucleotide (GenBank) : Z22571 Y.lipolytica orotate phosphoribosyl transferase gene.
Nucleotide (GenBank) : Z23265 Y.lipolytica CRF1 gene encoding product required for copper.
Nucleotide (GenBank) : Z22570 Y.lipolytica signal recognition particle protein (SRP19) gene.
Nucleotide (GenBank) : Z46872 Y.lipolytica gene for exo-1,3-beta-glucanase/1,3-beta-D-glucan.
Nucleotide (GenBank) : Z23264 Y.lipolytica MTP1 and MTP2 genes encoding metallothionein-I and metallothionein-II.
Nucleotide (GenBank) : KC585416 Large subunit ribosomal RNA gene, partial sequence
Nucleotide (GenBank) : LJBI00000000 Yarrowia lipolytica strain W29, whole genome shotgun sequencing project
Maldonado P, Charpentier M. Fermentation process for the production of citric and isocitric acids. US Patent 3,997,399 dated Dec 14 1976
Gaillardin CM, et al. A study of copulation, sporulation and meiotic segregation in Candida lipolytica. Arch. Mikrobiol. 92: 69-83, 1973. PubMed: 4725824
Treton B, Heslot H. Etude de quelques proprietes de l'aconitase de la levure Saccharomycopsis lipolytica. Agric Biol Chem 42: 1201-1206, 1978.
French Patent 72/41 913
Souciet JL, et al. Genomic Exploration of the Hemiascomycetous Yeasts: 1. A set of yeast species for molecular evolution studies. FEBS Lett. 487: 3-12, 2000.
Casaregola S, et al. Genomic Exploration of the Hemiascomycetous Yeasts: 17. Yarrowia lipolytica. FEBS Lett. 487: 95-100, 2000.
Knutsen AK, et al. Polyphasic re-examination of Yarrowia lipolytica strains and the description of three novel Candida species: Candida oslonensis sp. nov., Candida alimentaria sp. nov. and Candida hollandica sp. nov. Int. J. Syst. Evol. Microbiol. 57: 2426-2435, 2007. PubMed: 17911320
Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009. PubMed: 19664262
Fickers P, et al. Identification and characterisation of LIP7 and LIP8 genes encoding two extracellular triacylglycerol lipases in the yeast Yarrowia lipolytica. Fungal Genet. Biol. 42: 264-274, 2005. PubMed: 15707847
Butler G, et al. Evolution of the MAT locus and its Ho endonuclease in yeast species. Proc. Natl Acad. Sci. USA 101: 1632-1637, 2004. PubMed: 14745027
Casaregola S, et al. Ylli, a non-LTR retrotransposon L1 family in the dimorphic yeast Yarrowia lipolytica. Mol. Biol. Evol. 19: 664-677, 2002. PubMed: 11961100
Kerscher S, et al. The complete mitochondrial genome of Yarrowia lipolytica. Comp. Funct. Genomics 2: 80-90, 2001. PubMed: 18628906
Mauersberger S, et al. Insertional mutagenesis in the n-alkane-assimilating yeast Yarrowia lipolytica: generation of tagged mutations in genes involved in hydrophobic substrate utilization. J. Bacteriol. 183: 5102-5109, 2001. PubMed: 11489863
Richard M, et al. Tagging morphogenetic genes by insertional mutagenesis in the yeast Yarrowia lipolytica. J. Bacteriol. 183: 3098-3107, 2001. PubMed: 11325938
Vernis L, et al. Only centromeres can supply the partition system required for ARS function in the yeast Yarrowia lipolytica. J. Mol. Biol. 305: 203-217, 2001. PubMed: 11124900
Pomraning KR, Baker SE. Draft genome sequence of the dimorphic yeast Yarrowia lipolytica strain W29. Genome Announc 3: e01211-15, 2015. PubMed: 26607882
Gaillardin CM, et al. A study of copulation, sporulation and meiotic segregation in Candida lipolytica. Arch. Mikrobiol. 92: 69-83, 1973. PubMed: 4725824
