Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Yes
AATATGACGCAGCCATCACAGGTCACATTGATATGATATAGCCCGCCCGCAGATCATCTAATGATCTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGATTTGCCTTCGGGCTAAACTATATCCATAACACCTGTGAACTGTTGATTGACTTCGGTCAATATTTTTACAAACATTGTGTAATGAACGTCATGTTATAATAACAAATATAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAACTTGCGCTCTCTGGTATTCCGGAGAGCATGCCTGTTTGAGTGTCATGAAATCTCAACCATTAGGGTTTCTTAATGGCTTGGATTTGGACGTTTGCCAGTCAAATGGCTCGTCTTAAAAGAGTTAGTGAATTTAACATTTGTCTTCTGGCGTAATAAGTTTCGCTGGGCTGATAGTGTGAAGTTTGCTTCTAATCGTCCGCAAGGACAATTCTTGAACTCTGGCCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGAGAATCATTAGTGATTTGCCTTCCGGCTAAACTATATTCATAAC
Nucleotide (GenBank) : LDEP00000000 Cutaneotrichosporon curvatus strain SBUG-Y 855, whole genome shotgun sequencing project
Nucleotide (GenBank) : EU266558 ITS including 5.8S rRNA gene
Nucleotide (GenBank) : BCJH00000000 Cryptococcus curvatus strain JCM 1532, whole genome shotgun sequencing project
Nucleotide (GenBank) : Y10422 delta-9 fatty acid desaturase gene, Ole1
Nucleotide (GenBank) : AF189834 26S ribosomal RNA gene, partial sequence
Diddens HA, Lodder J. Die anaskosporogenen Hefen, zweite Halfte. Amsterdam: North-Holland; 1942.
Meesters PA, Eggink G. Isolation and characterization of a delta-9 fatty acid desaturase gene from the oleaginous yeast Cryptococcus curvatus CBS 570. Yeast 12: 723-730, 1996. PubMed: 8813759
Fell JW, et al. Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int. J. Syst. Evol. Microbiol. 50: 1351-1371, 2000. PubMed: 10843082
Aono R. Taxonomic distribution of alkali-tolerant yeasts. Syst. Appl. Microbiol. 13: 394-397, 1990.
Sugita T, et al. Phylogenetic and taxonomic heterogeneity of Cryptococcus humicolus by analysis of the sequences of the internal transcribed spacer regions and 18S rDNA, and the phylogenetic relationships of C. humicolus, C. curvatus, and the genus Trichosporon. Microbiol. Immunol. 44: 455-461, 2000. PubMed: 10941928
Scorzetti G, et al. Systematics of basidiomycetous yeasts: a comparison of large subunit D1/D2 and internal transcribed spacer rDNA regions. FEMS Yeast Res. 2: 495–517, 2002. PubMed: 12702266
Takashima M, et al. Selection of orthologous genes for construction of a highly resolved phylogenetic tree and clarification of the phylogeny of Trichosporonales species. PLoS One 10: e0131217, 2015. PubMed: 26241762
Hofmeyer T, et al. Draft genome sequence of Cutaneotrichosporon curvatus DSM 101032 (formerly Cryptococcus curvatus), an oleaginous yeast producing polyunsaturated fatty acids. Genome Announc 4: e00362-16, 2016. PubMed: 27174275
Liu XZ, et al. Towards an integrated phylogenetic classification of the Tremellomycetes. Stud. Mycol. 81: 85-147, 2015. PubMed: 26955199
