Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Yes
CATTAACGCGCCGTGGGGGGTTGGACCTCCTAGACCGGAGGAACCCCGGCCCCCTCACCTGGCCACCCTTGTCTATTTTTACCTGTTGCTTCGGCGGGCCTGCAGCGATGCTGCCGGGGGAGTTTTCACTCCCCGGGCTCGTGCCCGCCGAGGACACCGCTAGAACTTCTGGTGAACGATTGACATCTGAGAAAATAACTATAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCAACCCTCAAGCGCGGCTTGTGTGTTGGGCCTTCGTCCCCCCGTGGACGTGCCCGAAATGCAGCGGCGGCGTCGTGTTCCGGTGCCCGAGCGTATGGGGCTTTGTCACCCGCTCTAGAGGCCCGGCCGGCTCCGGCCCCATCTCAAACCCTTCGAGGGAGGGCGGTCTTCGGGCCGGTCTCCCCACCAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAG
Nucleotide (GenBank) : M63096 Blastomyces dermatitidis 18S ribosomal RNA.
Nucleotide (GenBank) : U37772 Ajellomyces dermatitidis WI-1 adhesin gene, complete cds.
Nucleotide (GenBank) : AF159367 Ajellomyces dermatitidis bacterial-type chitinase (CTS1) mRNA,
Complete Genome (GenBank) : AEII00000000 Ajellomyces dermatitidis ATCC 26199, whole genome shotgun sequencing project
Brummer E, et al. Macrophages and fungi: in vitro effects of method of macrophage induction, activation by different stimuli, and soluble factors on Blastomyces. J. Reticuloendothel. Soc. 28: 507-518, 1980. PubMed: 7463412
Harvey RP, et al. Mouse model of pulmonary blastomycosis: utility, simplicity, and quantitative parameters. Am. Rev. Respir. Dis. 117: 695-703, 1978. PubMed: 646221
Hogan LH, Klein BS. Transforming DNA integrates at multiple sites in the dimorphic fungal pathogen Blastomyces dermatitidis. Gene 186: 219-226, 1997. PubMed: 9074500
Sorensen KN, et al. Murine models of blastomycosis, coccidioidomycosis, and histoplasmosis. Mycopathologia 146: 53-65, 1999.
Shearer G Jr., Larsh HW. Chitin synthetase from the yeast and mycelial phases of Blastomyces dermatitidis. Mycopathologia 90: 91-96, 1985. PubMed: 3159966
Brown EM, et al. Phylogenetic analysis reveals a cryptic species Blastomyces gilchristii, sp. nov. within the human pathogenic fungus Blastomyces dermatitidis. PLoS One 8: e59237, 2013. PubMed: 23533607
Theodoro RC, et al. PRP8 intein in Ajellomycetaceae family pathogens: Sequence analysis, splicing evaluation and homing endonuclease activity. Fungal Genet Biol 48: 80-91, 2011. PubMed: 20682355
Meece JK, et al. Genetic diversity in Blastomyces dermatitidis: implications for PCR detection in clinical and environmental samples. Med Mycol 48: 285-290, 2010. PubMed: 19626547
Nemecek JC, Wuthrich M, Klein BS. Global control of dimorphism and virulence in fungi. Science 312: 583-588, 2006. PubMed: 16645097
