Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
TCCGTAGGTGAACCTGCGGAGGGATCATTACAAGTTGACCCCGGCCCTCGGGCCGGGATGTTCACAACCCTTTGTTGTCCGACTCTGTTGCCTCCGGGGCGACCCTGCCTCCGGGCGGGGGCCCCGGGTGGACATTTCAAACTCTTGCGTAACTTTGCAGTCTGAGTAAATTTAATTAATAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCGACGCGGTCCGCCGCGCGCCTCAAATCGACCGGCTGGGTCTTTCGTCCCCTCAGCGTTGTGGAAACTATTCGCTAAAGGGTGCCGCGGGAGGCCACGCCGTAAAACAACCCCATTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATC
Nucleotide (GenBank) : HQ263345 ITS including 5.8S rRNA gene
Haugland RA, et al. Quantitative PCR analysis of selected Aspergillus, Penicillium and Paecilomyces species. System. Appl. Microbiol. 27:198-210, 2004.
Vesper S. Developing the EPA relative moldiness index based on mold-specific quantitative PCR. The Synergist April: 39-43, 2006.
Vesper S, et al. Development of an environmental relative moldiness index for US homes. JOEM 49:829-833, 2007.
Meklin T, et al. Quantitative PCR analysis of house dust can reveal abnormal mold conditions. J Environ Monit 6: 615-620, 2004. PubMed: 15237292
Pietarinen V, et al. Quantitative PCR analysis of fungi and bacteria in building materials and comparison to culture-based analysis. J. Environ. Monit. 10: 655-663, 2008.
