Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Yes
GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCAATACAAGCCGGCCGGTTTGCTGTTGCAGTTCGTTCGAAAGAGCGGTTTGCGCTGTCTTCCGGTTGGTAAGCCAGCACCCGCCTCCCCGCAAGGGGCAGGTTTGGGTACCTGGTAAACCCTTTGTGAACCAAAACAAACCTTTCGCTTCGGCAGCTGGGCCCCTTCTGGGACCTGTCAGCCTGCCGCTAGCACCAAACAAAAAAACTTGTTGTCAAAACATTGTCTGATAACCAAAATTTTCGAATGAAAATCAAAACTTTCAACAACGGATCTCTTGGTTCCCGCATCGATGAAGAACGCAGCGAAACGCGATAGTTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCATTGGTATTCCTTTGGGCATGTCTGTTTGAGCGTCATTACAACCCTCAGCTACCCGCTGGTTTTGAACCCGAACGGTTTCCCCCTAATAGGGGATCCGAGCCGGTTTTAAAGTTGTAAGCTCTGCTGGCCGCTCCGCCTCCAACCAGAACATAGTAAAACACTACTTTTGTTAGGGTCAAGCGGAACGGTTTTTCGGCCTGGAAAAAACCTACCCATTTCTCAAGGTTTGACCTCAGATCAGACAAGGATACCCGCTGAACTTAAGCATATCAATAA
ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGAGTCTTTCGGCTTCCGAGTTGTAATTTGAAGAGGATGTTTCGGTGCGACCTGGGCCTAAGTTCCTTGGAACAGGACGTCATGGAGGGTGAGAATCCCGTACATGGCTGCAGGTTTGCTTCTATGTGAAACTCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCGGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTCGCCTTCAGCTGATCAACCTTCCTTCTGGTTGGTGCACTCTGCTGTTGGCGGGCCAGCATCAGTTGGGGCGGCGGGATAAAGGCAGCAGGAATGTGGCTCGTTTCGGCGAGTGTTATAGCCTGCTGTGTCATGCCGCCAGTCCCGACTGAGGTCCGCGGTTCGCCTAGGATGCTGGCTTAATGGTTGTAAGCGAC
Nucleotide (GenBank) : KU729032 ITS including 5.8S rRNA gene
Nucleotide (GenBank) : KU729116 D1/D2 region of 28S rRNA gene
Nucleotide (GenBank) : X97073 A.oligospora gene encoding lectin.
Nucleotide (GenBank) : AJ001986 Arthrobotrys oligospora 18S ssu ribosomal RNA.
Nucleotide (GenBank) : X94121 A.oligospora cuticle-degrading serine protease gene.
Nucleotide (GenBank) : ADOT00000000 Arthrobotrys oligospora ATCC 24927, whole genome shotgun sequencing project
Borrebaeck CA, et al. Isolation and partial characterization of a carbohydrate-binding protein from a nematode-trapping fungus. J. Bacteriol. 159: 53-56, 1984. PubMed: 6539773
Tunlid A, et al. Purification and characterization of an extracellular serine protease from the nematode-trapping fungus Arthrobotrys oligospora. Microbiology 140: 1687-1695, 1994. PubMed: 8075805
Nordbring‐Hertz B. The influence of medium composition and additions of animal origin on the formation of capture organs in Arthrobotrys oligospora. Physiol Plant 21: 52-65, 1968.
Nordbring-Hertz B, Brinck B. Qualitative characterization of some peptides inducing morphogenesis in the nematode- trapping fungus Arthrobotrys oligospora. Physiol Plant 31: 59-63, 1974.
Lysek G, Nordbring-Hertz B. An endogenous rhythm of trap formation in the nematophagous fungus Arthrobotrys oligospora. Planta 152: 50-53, 1981.
Nordbring‐Hertz B. Scanning electron microscopy of the nematode-trapping organs in Arthrobotrys oligospora. Physiol Plant 26: 279-284, 1972.
Nordbring‐Hertz B. Peptide-induced morphogenesis in the nematode-trapping fungus Arthrobotrys oligospora. Physiol Plant 29: 223-233, 1973.
Nordbring‐Hertz B, Mattiasson B. Action of a nematode-trapping fungus shows lectin-mediated host–microorganism interaction. Nature 281: 477-479, 1979.
Tunlid A, Jansson S. Proteases and their involvement in the infection and immobilization of nematodes by the nematophagous fungus Arthrobotrys oligospora. Appl. Environ. Microbiol. 57: 2868-2872, 1991.
Nordbring-Hertz B. Nematode-induced morphogenesis in the predacious fungus Arthrobotrys oligospora. Nematologica 23: 443-451, 1977.
Jansson HB, Nordbring-Hertz B. Interactions between nematophagous fungi and plant-parasitic nematodes: attraction, induction of trap formation and capture. Nematologica 26: 383-389, 1980.
Olsson S, Persson Y. Transfer of phosphorus from Rhizoctonia solani to the mycoparasite Arthrobotrys oligospora. Mycol. Res. 98: 1065-1068, 1994.
Nordbring-Hertz B, St?lhammar-Carlemalm M. Capture of nematodes by Arthrobotrys oligospora, an electron microscope study. Can. J. Bot. 56: 1297-1307, 1978.
Yang J, et al. Genomic and proteomic analyses of the fungus Arthrobotrys oligospora provide insights into nematode-trap formation. PLoS Pathog 7: e1002179, 2011. PubMed: 21909256
Ahren D, et al. Low genetic diversity among isolates of the nematode-trapping fungus Duddingtonia flagrans: evidence for recent worldwide dispersion from a single common ancestor. Mycol Res 108: 1205-1214, 2004. PubMed: 15535071
