| 產(chǎn)品名稱 |
HFBCB31 |
| 商品貨號 |
B227812 |
| Designations |
HFBCB31 |
| GenBank Number |
M78393
|
| Species |
Homo sapiens, human |
| Applications |
Expected product size (bp): 150. Observed product sizes (bp): 152 (human). |
| Vector |
Construct size (kb): 5.400000095367432 DESCRIPTION OF VECTOR COMPONENT: Name of vector: pBluescript SK- Intact vector size: 2.960 Type of vector: phagemid Vector end: EcoRI Vector end: EcoRI Cloning sites: KpnI ApaI DraII XhoI (SalI HincII AccI) ClaI HindIII EcoRV EcoRI PstI SmaI BamHI SpeI XbaI EagI NotI SacII BstXI SacI Polylinker sites: SacI BstXI SacII NotI EagI XbaI SpeI BamHI SmaI PstI EcoRI EcoRV HindIII (ClaI Bsp106I) (HincII AccI SalI) XhoI (Eco0109I DraII ApaI) KpnI Construction: pUC19 Host range: Escherichia coli Features (with orientation and position when available): replicon: f1, -> insert detection: lacZ', <- primer site: M13-20, -> promoter: T7, -> MCS: KpnI...SacI, -> promoter: T3, <- promoter: lac, <- primer site: M13 reverse, <- replicon: pMB1 marker(s): ampR, <- Cross references: |
| Insert |
DNA: cDNA DESCRIPTION OF INSERT COMPONENT: Genome: Homo sapiens Gene symbol: GST* Gene name: glutathione S-transferase Contains complete coding sequence?: U Chromosome: 21 Genome: Homo sapiens Gene symbol: D21S363E Genomic copy number: unique Gene name: DNA Segment, single copy, expressed Contains complete coding sequence?: U Chromosome: 21; Localization: 21 Tissue: fetal brain, female, 17-18 wk (Stratagene 936206) Type of DNA: cDNA Insert end: Modification: EcoRI linkers Insert end: Modification: EcoRI linkers Insert size (kb): 2.4 Cross references: DNA Seq. Acc.: M78393; EST: EST00541; Primer: M13 Forward Insert lengths(kb): 2.400000095367432 Tissue: fetal brain, female, 17-18 wk (Stratagene 936206) Gene product: glutathione S-transferase [GST*] |
| Insert Size (kb) |
2.400 |
| Biosafety Level |
1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Shipping Information |
Distributed: DNA (dried). Rehydrate with TE. (amount: 200 ng) |
| Comments |
Restriction digests of the clone give the following sizes (kb): EcoRI--3.0, 1.3, 1.1; PstI--5.4; HindIII--3.6, 1.8. EST00541 can be detected in genomic DNA using the following oligonucleotides (5'-3'): CCGTCGGTAACAGAAAACTC and ACACAGTCCTGTAATACCCTCC. The 1.1 kb fragment contains EST00541. The 1.3 kb fragment does not map to chromosome 21 and contains sequences homologous to glutathione S-transferase. Expected product size (bp): 150. Observed product sizes (bp): 152 (human). |
| References |
Adams MD, et al. Sequence identification of 2,375 human brain genes. Nature 355: 632-634, 1992. PubMed: 1538749
Durkin AS, et al. Chromosomal assignment of 39 human brain expressed sequence tags (ESTs) by analyzing fluorescently-labeled PCR products from hybrid cell panels. Genomics 14: 808-810, 1992. PubMed: 1427913
Maglott DR, et al259 human brain expressed sequence tags (ESTs): chromosome localization, subregional assignment, and sequence analysisIn: Maglott DR, et alIdentification of transcribed sequencesNew YorkPlenum Presspp. 273-288, 1994
|