Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Yes
After 2 weeks advancing zone appressed, mycelium white with older growth turning butyrous and orange as zoosporangia are formed.
CGAGTAATGGCGAATGAAACGGGAAAAGCCCAAATTTGAAATCTCCTAGCTTTTATCGCTAGGCGAGTTGTAATTTGTAGAAGGTCTTCATCTGAACTGTGTTTGCTAAAGTCCATTGGAAAATGGCGGGCCTTTATGGTCCTCAAGTCGTAGAGGGTGACAACCCCGTTCTTGGCATTCTACTAGTTCTTTTGTATGATTCCTTCAAAGAGTCGGATTGTTTGGGAATGCAATCCAAAACGGGTGGTAAATTCCATCCAAGGCTAAATATTAGCAAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTCTGAAGAGAGAGTTCAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAACGATTGTTGCTTTTGGTTTCGGCCTTGAGCGAGTCAGCAGCAGTTTTAAACGGTAAAGAAGTGCTTGTGGAAGGTAGTTTTCTTTGGAAAATGTTATAGCCATAAGTAACTGTGCCGGTTAGGACTGAGGATCGCTTTTAAGTGTCTTGTCGAGGAATTTTGGGCCGTTAGCGCCAAGGCCTTGGGCTTGCTCAAGACTTGGTGTTAACTGTTCAGGACGACCAAACACAAGGCCTTAAAAT
Nucleotide (GenBank) : JX094785 D1/D2 region of 28S rRNA gene
Nucleotide (GenBank) : ACDU00000000 Allomyces macrogynus ATCC 38327, whole genome shotgun sequencing project
Morrison PJAllomyces macrogynusIn: Morrison PJLower fungi in the laboratoryAthens, GAUniv. Georgiapp. 45-46, 1978
Eisenberg A, Mascarenhas JP. Male gamete messenger RNAs in Allomyces. Exp. Mycol. 5: 173-177, 1981.
Pommerville J. Analysis of gamete and zygote motility in Allomyces. Exp. Cell Res. 113: 161-172, 1978. PubMed: 565293
. . Protoplasma 100: 323-343, 1979.
Aronson JM, Sandstedt V. Allomyces macrogynusIn: Aronson JM, Sandstedt V. Lower fungi in the laboratory. Athens, GA Univ. Georgia. pp. 51-52, 1978.
Barstow WE. Allomyces macrogynusIn: Barstow WE. Lower fungi in the laboratory, Athens, GA Univ. Georgia. pp. 49-50, 1978.
Pommerville J. Allomyces macrogynus--gametes and fertilizationIn: Pommerville J. Lower fungi in the laboratory. Athens, GA Univ. Georgia. pp. 47-48, 1978.
Liu YJ, Hodson MC, Hall BD. Loss of the flagellum happened only once in the fungal lineage: phylogenetic structure of kingdom Fungi inferred from RNA polymerase II subunit genes BMC Evol Biol 6: 74, 2006. PubMed: 17010206
Spatafora JW, et al. A phylum-level phylogenetic classification of zygomycete fungi based on genome-scale data. Mycologia 108:1028-1046, 2016. PubMed: 27738200
