Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Yes
GTCTCCGTTGGTGAACCAGCGGAGGGATCATTACTGAGTTGAAAAACTCCAACCCCTGTGAACATAACCTCTGTCGTTGCTTCGGCGGGCACGCCCGCCGGAGGTTCAAAACTCTTATTTTTTCCAGTATCTCTGAGCCTGAAAGACAAATAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCGGTATTCCGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCTCGGCTTGGTGTTGGGGCGCCCGGGCCCTCCGCGGCCCGGGGCCCCCAAGTTCATCGGCGGGCTCGGCGGTACACTGAGCGCAGTAAAACGCGGTAAAACGCGAACCTCGTTCGGATCGTCCCGGCGTGCTCCAGCCGCTAAACCCCCAATTTTTTAAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA
Nucleotide (GenBank) : GU327633 ITS including 5.8S rRNA gene
Nucleotide (GenBank) : AACU00000000 Magnaporthe oryzae 70-15, whole genome shotgun sequencing project
Dean RA, et al. The genome sequence of the rice blast fungus Magnaporthe grisea. Nature 434: 980-986, 2005.
Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009. PubMed: 19664262
Glenn AE, et al. Comparative genomic and phylogenetic investigation of the xenobiotic metabolizing arylamine N-acetyltransferase enzyme family. FEBS Lett 584: 3158-3164, 2010. PubMed: 20621844
Mosquera G, et al. Interaction transcriptome analysis identifies Magnaporthe oryzae BAS1-4 as Biotrophy-associated secreted proteins in rice blast disease. Plant Cell 21: 1273-1290, 2009. PubMed: 19357089
Flipphi M, et al. Biodiversity and evolution of primary carbon metabolism in Aspergillus nidulans and other Aspergillus spp. Fungal Genet Biol 46: S19-S44, 2009. PubMed: 19610199
Kito H, et al. MgLig4, a homolog of Neurospora crassa Mus-53 (DNA ligase IV), is involved in, but not essential for, non-homologous end-joining events in Magnaporthe grisea. Fungal Genet Biol 45: 1543-1551, 2008. PubMed: 18854221
Odenbach D, et al. The transcription factor Con7p is a central regulator of infection-related morphogenesis in the rice blast fungus Magnaporthe grisea. Mol Microbiol 64: 293-307, 2007. PubMed: 17378924
Hof C, et al. Ferricrocin synthesis in Magnaporthe grisea and its role in pathogenicity in rice. Mol Plant Pathol 8: 163-172, 2007. PubMed: 20507488
Rehmeyer C, et al. Organization of chromosome ends in the rice blast fungus, Magnaporthe oryzae. Nucleic Acids Res 34: 4685-4701, 2006. PubMed: 16963777
Flipphi M, et al. Functional analysis of alcS, a gene of the alc cluster in Aspergillus nidulans. Fungal Genet. Biol. 43: 247-260, 2006. PubMed: 16531087
Kim S, et al. MHP1, a Magnaporthe grisea hydrophobin gene, is required for fungal development and plant colonization. Mol Microbiol 57: 1224-1237, 2005. PubMed: 16101997
Bohnert HU, et al. A putative polyketide synthase/peptide synthetase from Magnaporthe grisea signals pathogen attack to resistant rice. Plant Cell 16: 2499-2513, 2004. PubMed: 15319478
